-
PurposeArabinose inducible Cas9 in a broad host range backbone.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBTBX-2
- Backbone size w/o insert (bp) 3831
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes strain SF370
-
Insert Size (bp)4107
- Promoter pBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccataagattagcggatcctacctgacgc
- 3′ sequencing primer ggtgggtatgtggtcgaaggctgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX2-Cas9 was a gift from Ryan Gill (Addgene plasmid # 85811 ; http://n2t.net/addgene:85811 ; RRID:Addgene_85811)