Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #71656)


Item Catalog # Description Quantity Price (USD)
Plasmid 71656 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 2564
  • Total vector size (bp) 2584
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    SS9 gRNA
  • gRNA/shRNA sequence
  • Species
    Escherichia coli
  • Promoter J23119

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ataagggcgacacggaaatgttgaatactc
  • 3′ sequencing primer tttatttgatgcctggcagttccctactctcgcatgg
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SS9_RNA was a gift from Ryan Gill (Addgene plasmid # 71656 ; ; RRID:Addgene_71656)
  • For your References section:

    Rapid and Efficient One-Step Metabolic Pathway Integration in E. coli. Bassalo MC, Garst AD, Halweg-Edwards AL, Grau WC, Domaille DW, Mutalik VK, Arkin AP, Gill RT. ACS Synth Biol. 2016 Apr 22. 10.1021/acssynbio.5b00187 PubMed 27072506