Human a4 nicotinic subunit crystallization construct
(Plasmid
#85841)
-
PurposepEZT-BM vector with alpha4 gene after CMV promoter, published crystallization construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85841 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEZT-BM
-
Backbone manufacturerHibbs Lab
- Total vector size (bp) 8657
-
Vector typeMammalian Expression ; Baculovirus (bacmam) production and mammalian expression
-
Selectable markersmEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman a4 nAChR subunit crystallization construct
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1239
-
Entrez GeneCHRNA4 (a.k.a. BFNC, EBN, EBN1, NACHR, NACHRA4, NACRA4)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ttgcctttctctccacaggt
- 3′ sequencing primer catgatacaaaggcattaaag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJon Lindstrom at the University of Pennsylvania
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human a4 nicotinic subunit crystallization construct was a gift from Ryan Hibbs (Addgene plasmid # 85841 ; http://n2t.net/addgene:85841 ; RRID:Addgene_85841) -
For your References section:
X-ray structure of the human alpha4beta2 nicotinic receptor. Morales-Perez CL, Noviello CM, Hibbs RE. Nature. 2016 Oct 3;538(7625):411-415. doi: 10.1038/nature19785. 10.1038/nature19785 PubMed 27698419