pOP461
(Plasmid
#85934)
-
PurposeEncodes the Anti-Ebola 4G7 monoclonal antibody. Chimeric - mouse variable regions, human constant regions.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85934 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneUnknown
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-Ebola 4G7 monoclonal antibody
-
SpeciesH. sapiens (human), M. musculus (mouse)
- Promoter AOX1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctggttccaattgacaagcttttgattttaacg
- 3′ sequencing primer 3_AOX1_primer (gcaaatggcattctgacatcc)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOP461 was a gift from Timothy Lu (Addgene plasmid # 85934 ; http://n2t.net/addgene:85934 ; RRID:Addgene_85934) -
For your References section:
Production of Functional Anti-Ebola Antibodies in Pichia pastoris. Purcell O, Opdensteinen P, Chen W, Lowenhaupt K, Brown A, Hermann M, Cao J, Tenhaef N, Kallweit E, Kastilan R, Sinskey AJ, Perez-Pinera P, Buyel JF, Lu TK. ACS Synth Biol. 2017 Aug 17. doi: 10.1021/acssynbio.7b00234. 10.1021/acssynbio.7b00234 PubMed 28786662