Skip to main content
Addgene

pMH0001
(Plasmid #85969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85969 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR-SFFV-dCas9-BFP-KRAB
  • Modifications to backbone
    insertion of minimal UCOE upstream of SFFV promoter
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    BFP fluorescence

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9
  • Alt name
    nuclease-deficient Cas9
  • Species
    Streptococcus pyogenes
  • Mutation
    D10A, H840A
  • Promoter SFFV
  • Tag / Fusion Protein
    • BFP-KRAB (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTGCAGGGGAAAGAATAGTAGAC
  • 3′ sequencing primer CTGAACTTCTCTATTCTTGGTTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH0001 was a gift from Jonathan Weissman (Addgene plasmid # 85969 ; http://n2t.net/addgene:85969 ; RRID:Addgene_85969)
  • For your References section:

    A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. Adamson B, Norman TM, Jost M, Cho MY, Nunez JK, Chen Y, Villalta JE, Gilbert LA, Horlbeck MA, Hein MY, Pak RA, Gray AN, Gross CA, Dixit A, Parnas O, Regev A, Weissman JS. Cell. 2016 Dec 15;167(7):1867-1882.e21. doi: 10.1016/j.cell.2016.11.048. 10.1016/j.cell.2016.11.048 PubMed 27984733