-
Purposeexpress NSD2 E1099K mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86011 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneUTF-8'en-us'pLVX-IRES-Neo_DS_SEQ
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8316
- Total vector size (bp) 8316
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNSD2 E1099K mutant
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4098
-
MutationE1099K; K1002R (please see depositor comments below)
-
GenBank IDNM_001042424
-
Entrez GeneNSD2 (a.k.a. KMT3F, KMT3G, MMSET, RAUST, REIIBP, TRX5, WHS, WHSC1)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag tag D Y K D D D D K (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer taggcgtgtacggtgggagg
- 3′ sequencing primer aggtgtatcttatacacgt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGNF
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that mutation K1002R was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LVXN-Neo-NSD2-E1099K was a gift from Darrin Stuart (Addgene plasmid # 86011 ; http://n2t.net/addgene:86011 ; RRID:Addgene_86011) -
For your References section:
Global chromatin profiling reveals NSD2 mutations in pediatric acute lymphoblastic leukemia. Jaffe JD, Wang Y, Chan HM, Zhang J, Huether R, Kryukov GV, Bhang HE, Taylor JE, Hu M, Englund NP, Yan F, Wang Z, Robert McDonald E 3rd, Wei L, Ma J, Easton J, Yu Z, deBeaumount R, Gibaja V, Venkatesan K, Schlegel R, Sellers WR, Keen N, Liu J, Caponigro G, Barretina J, Cooke VG, Mullighan C, Carr SA, Downing JR, Garraway LA, Stegmeier F. Nat Genet. 2013 Nov;45(11):1386-91. doi: 10.1038/ng.2777. Epub 2013 Sep 29. 10.1038/ng.2777 PubMed 24076604