Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pThermeleon
(Plasmid #86120)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86120 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    Novagen
  • Modifications to backbone
    Replaced pETDuet-1 T7 promoters and ORFs with: pR/pL and pLacI pTlpA
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TlpA
  • Species
    S. Typhimurium
  • Insert Size (bp)
    1116
  • Mutation
    D341A
  • GenBank ID
    M88208.1
  • Promoter pTlpA

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgcgtccggcgtaga
  • 3′ sequencing primer ATCTTCATGTCGGGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mWasabi
  • Species
    Synthetic
  • Insert Size (bp)
    756
  • GenBank ID
    EU024648.1
  • Promoter pTlpA
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gttgcacacagctggaaaac
  • 3′ sequencing primer CATCAGTGTATGGTGgcg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    TcI38
  • Alt name
    Lambda Repressor
  • Insert Size (bp)
    714
  • Mutation
    A67T, M1V, L65S, K68R, F115L, D126G, D188G
  • Promoter pR/pL, pLacI

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aagttggacatcacctcc
  • 3′ sequencing primer ACTACTGGGCTGCTTCC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    mCherry
  • Promoter pR/pL
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTGAGCACATCAGCAGG
  • 3′ sequencing primer ggaggtgatgtccaactt
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    cI
  • Alt name
    Lambda Repressor
  • Species
    Bacteriophage Lambda
  • Insert Size (bp)
    714
  • Promoter pTlpA

Cloning Information for Gene/Insert 5

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACCGTTTACGAGATC
  • 3′ sequencing primer CCGCTACAGGGCGCG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pThermeleon was a gift from Mikhail Shapiro (Addgene plasmid # 86120 ; http://n2t.net/addgene:86120 ; RRID:Addgene_86120)
  • For your References section:

    Tunable thermal bioswitches for in vivo control of microbial therapeutics. Piraner DI, Abedi MH, Moser BA, Lee-Gosselin A, Shapiro MG. Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14. 10.1038/nchembio.2233 PubMed 27842069