Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LentiCRISPR-sgUBA5
(Plasmid #86132)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86132 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLentiCRISPR v1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting UBA5
  • gRNA/shRNA sequence
    AAGCAGCAGAACATACTCTG
  • Entrez Gene
    UBA5 (a.k.a. DEE44, EIEE44, SCAR24, THIFP1, UBE1DC1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer CCCAGAGAGGGCCTATTTCCCA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR-sgUBA5 was a gift from David Sabatini (Addgene plasmid # 86132 ; http://n2t.net/addgene:86132 ; RRID:Addgene_86132)
  • For your References section:

    Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Wang T, Yu H, Hughes NW, Liu B, Kendirli A, Klein K, Chen WW, Lander ES, Sabatini DM. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. 10.1016/j.cell.2017.01.013 PubMed 28162770