PP7 guide
(Plasmid
#86168)
-
PurposeExpresses S. Pyogenes guide with PP7 aptamer in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneSpCas9 guide
-
Backbone manufacturerFeng Zhang
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePP7 guide
-
Insert Size (bp)881
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gactatcatatgcttaccgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PP7 guide was a gift from Amit Choudhary (Addgene plasmid # 86168 ; http://n2t.net/addgene:86168 ; RRID:Addgene_86168) -
For your References section:
Multidimensional chemical control of CRISPR-Cas9. Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD, Choudhary A. Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub 2016 Oct 31. 10.1038/nchembio.2224 PubMed 27820801