pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer
(Plasmid
#86195)
-
PurposeU6 based expression of N meningitidis sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
- Total vector size (bp) 9023
-
Modifications to backboneContains NmCas9 sgRNA expression cassette with BfuAI sites for cloning guide RNAs into the cassette
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenmCas9 sgRNA cloning cassete
-
gRNA/shRNA sequenceBfuAI cloning cassette
-
SpeciesN. meningitidis
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age! (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
- 3′ sequencing primer CCTCGAGCCGCGGCCAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer was a gift from Scot Wolfe (Addgene plasmid # 86195 ; http://n2t.net/addgene:86195 ; RRID:Addgene_86195) -
For your References section:
NmeCas9 is an intrinsically high-fidelity genome-editing platform. Amrani N, Gao XD, Liu P, Edraki A, Mir A, Ibraheim R, Gupta A, Sasaki KE, Wu T, Donohoue PD, Settle AH, Lied AM, McGovern K, Fuller CK, Cameron P, Fazzio TG, Zhu LJ, Wolfe SA, Sontheimer EJ. Genome Biol. 2018 Dec 5;19(1):214. doi: 10.1186/s13059-018-1591-1. 10.1186/s13059-018-1591-1 PubMed 30518407