Skip to main content
Addgene

pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer
(Plasmid #86195)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86195 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Total vector size (bp) 9023
  • Modifications to backbone
    Contains NmCas9 sgRNA expression cassette with BfuAI sites for cloning guide RNAs into the cassette
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nmCas9 sgRNA cloning cassete
  • gRNA/shRNA sequence
    BfuAI cloning cassette
  • Species
    N. meningitidis
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age! (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
  • 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer was a gift from Scot Wolfe (Addgene plasmid # 86195 ; http://n2t.net/addgene:86195 ; RRID:Addgene_86195)
  • For your References section:

    NmeCas9 is an intrinsically high-fidelity genome-editing platform. Amrani N, Gao XD, Liu P, Edraki A, Mir A, Ibraheim R, Gupta A, Sasaki KE, Wu T, Donohoue PD, Settle AH, Lied AM, McGovern K, Fuller CK, Cameron P, Fazzio TG, Zhu LJ, Wolfe SA, Sontheimer EJ. Genome Biol. 2018 Dec 5;19(1):214. doi: 10.1186/s13059-018-1591-1. 10.1186/s13059-018-1591-1 PubMed 30518407