-
PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse Rosa26 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330
-
Backbone manufacturerAddgene 42230
-
Vector typeMammalian Expression, Mouse Targeting
-
Selectable markersNONE
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9-nickase and sgRNA against mouse rosa26 locus
-
gRNA/shRNA sequenceTGGGCGGGAGTCTTCTGGGC
-
SpeciesM. musculus (mouse)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-EN479 was a gift from Benoit Bruneau (Addgene plasmid # 86234 ; http://n2t.net/addgene:86234 ; RRID:Addgene_86234) -
For your References section:
Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Nora EP, Goloborodko A, Valton AL, Gibcus JH, Uebersohn A, Abdennur N, Dekker J, Mirny LA, Bruneau BG. Cell. 2017 May 18;169(5):930-944.e22. doi: 10.1016/j.cell.2017.05.004. 10.1016/j.cell.2017.05.004 PubMed 28525758