Ubiquitin K6C
(Plasmid
#86587)
-
PurposeBacterial expression of Ubiquitin K6C for cross linking studies
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86587 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMAL-c5X
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameUbiquitin
-
SpeciesH. sapiens (human)
-
MutationTEV site; K6C
-
Entrez GeneUBC (a.k.a. HMG20)
- Promoter Tac
-
Tag
/ Fusion Protein
- His6-MBP (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer MBP-F
- 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ubiquitin K6C was a gift from Sharon Rozovsky (Addgene plasmid # 86587 ; http://n2t.net/addgene:86587 ; RRID:Addgene_86587) -
For your References section:
Utilizing Selenocysteine for Expressed Protein Ligation and Bioconjugations. Liu J, Chen Q, Rozovsky S. J Am Chem Soc. 2017 Feb 10. doi: 10.1021/jacs.6b10991. 10.1021/jacs.6b10991 PubMed 28186733