-
PurposeFlag tagged mouse Brd4 expression construct for cell transfection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAdRSV-Sp-Flag
-
Backbone manufacturerPMID: 12490204
- Backbone size w/o insert (bp) 4260
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBrd4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4230
-
Entrez GeneBrd4 (a.k.a. Brd5, HUNK1, MCAP, WI-11513)
- Promoter RSV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer CCTCAGTGGATGTTGCCTTTAC
- 3′ sequencing primer GCATTCTAGTTGTGGTTTGTCC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RSV-Flag-Brd4 was a gift from Mario García-Domínguez (Addgene plasmid # 86616 ; http://n2t.net/addgene:86616 ; RRID:Addgene_86616) -
For your References section:
Association of bromodomain BET proteins with chromatin requires dimerization through the conserved motif B. Garcia-Gutierrez P, Mundi M, Garcia-Dominguez M. J Cell Sci. 2012 Aug 1;125(Pt 15):3671-80. Epub 2012 May 17. 10.1242/jcs.105841 PubMed 22595521