pHR-FKBP:mCherry-Rab7a
(Plasmid
#86638)
-
PurposeExpresses mCherry-tagged Rab7a
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8912
- Total vector size (bp) 10638
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFKBP-mCherry-Rab7a
-
Insert Size (bp)1728
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer gcttcccgagctctataaaagagc
- 3′ sequencing primer ccagaggttgattatcgataagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-FKBP:mCherry-Rab7a was a gift from Thomas Leonard & Ivan Yudushkin (Addgene plasmid # 86638 ; http://n2t.net/addgene:86638 ; RRID:Addgene_86638) -
For your References section:
PI(3,4,5)P3 Engagement Restricts Akt Activity to Cellular Membranes. Ebner M, Lucic I, Leonard TA, Yudushkin I. Mol Cell. 2017 Feb 2;65(3):416-431.e6. doi: 10.1016/j.molcel.2016.12.028. 10.1016/j.molcel.2016.12.028 PubMed 28157504