Skip to main content

pLenti-hSynapsin-Cre-WPRE
(Plasmid #86641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86641 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiviral
  • Backbone manufacturer
    Carlos Lois
  • Backbone size w/o insert (bp) 7944
  • Total vector size (bp) 9434
  • Modifications to backbone
    replaced the CMV promoter with hSynapsin promoter
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, Synthetic Biology
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre
  • Species
    Synthetic
  • Insert Size (bp)
    981
  • Promoter hSynapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gcagcggaggagtcgtgtcg
  • 3′ sequencing primer ccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-hSynapsin-Cre-WPRE was a gift from Fan Wang (Addgene plasmid # 86641 ; http://n2t.net/addgene:86641 ; RRID:Addgene_86641)
  • For your References section:

    Capturing and Manipulating Activated Neuronal Ensembles with CANE Delineates a Hypothalamic Social-Fear Circuit. Sakurai K, Zhao S, Takatoh J, Rodriguez E, Lu J, Leavitt AD, Fu M, Han BX, Wang F. Neuron. 2016 Nov 23;92(4):739-753. doi: 10.1016/j.neuron.2016.10.015. Epub 2016 Oct 27. 10.1016/j.neuron.2016.10.015 PubMed 27974160