CANE-LV envelope
(Plasmid #86666)

• Purpose: pCAGGS/ES-M21EnvA-VSVg-WPRE, used to package pseudotyped lentivirus
• Depositing Lab: Fan Wang
• Publication: Sakurai et al Neuron. 2016 Nov 23;92(4):739-753. doi: 10.1016/j.neuron.2016.10.015. Epub 2016 Oct 27.

Backbone

• Vector backbone: pCASGS/ES
• Backbone size w/o insert (bp): 4821
• Total vector size (bp): 7919
• Modifications to backbone: add WPRE to the 3' of the insert
• Vector type: Mammalian Expression, Mouse Targeting, Lentiviral, Synthetic Biology
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CANE-LV envelope
• Alt name: M21EnvA-VSVg
• Species: Synthetic
• Insert Size (bp): 1919
• GenBank ID: KX990266.1
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: cttcttctttttcctacagc
• 3′ sequencing primer: tttcacaaattttgtaatcc

Resource Information

• Supplemental Documents:
  • CANE-LV envelope sequence.txt
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry