Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

CANE-LV envelope
(Plasmid #86666)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86666 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.

Backbone

  • Vector backbone
    pCASGS/ES
  • Backbone size w/o insert (bp) 4821
  • Total vector size (bp) 7919
  • Modifications to backbone
    add WPRE to the 3' of the insert
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CANE-LV envelope
  • Alt name
    M21EnvA-VSVg
  • Species
    Synthetic
  • Insert Size (bp)
    1919
  • GenBank ID
    KX990266.1
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer cttcttctttttcctacagc
  • 3′ sequencing primer tttcacaaattttgtaatcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CANE-LV envelope was a gift from Fan Wang (Addgene plasmid # 86666 ; http://n2t.net/addgene:86666 ; RRID:Addgene_86666)
  • For your References section:

    Capturing and Manipulating Activated Neuronal Ensembles with CANE Delineates a Hypothalamic Social-Fear Circuit. Sakurai K, Zhao S, Takatoh J, Rodriguez E, Lu J, Leavitt AD, Fu M, Han BX, Wang F. Neuron. 2016 Nov 23;92(4):739-753. doi: 10.1016/j.neuron.2016.10.015. Epub 2016 Oct 27. 10.1016/j.neuron.2016.10.015 PubMed 27974160