Skip to main content
Addgene

pHAGE2 GFP-Atl1
(Plasmid #86679)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86679 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE2 GFP N-terminal
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 9916
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATL1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1700
  • Entrez Gene
    ATL1 (a.k.a. AD-FSP, FSP1, GBP3, HSN1D, SPG3, SPG3A, atlastin1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTCTATATAAGCAGAGCTCG
  • 3′ sequencing primer CATATAGACAAACGCACACC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yoko Shibata
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE2 GFP-Atl1 was a gift from Tom Rapoport (Addgene plasmid # 86679 ; http://n2t.net/addgene:86679 ; RRID:Addgene_86679)
  • For your References section:

    Cooperation of the ER-shaping proteins atlastin, lunapark, and reticulons to generate a tubular membrane network. Wang S, Tukachinsky H, Romano FB, Rapoport TA. Elife. 2016 Sep 13;5. pii: e18605. doi: 10.7554/eLife.18605. 10.7554/eLife.18605 PubMed 27619977