Skip to main content
Addgene

pAAV-Neo_CAG-Cas9
(Plasmid #86698)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86698 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAVS1-SA-2A-NEO-CAG-RTTA3 Addgene 60431
  • Backbone manufacturer
    Paul Gadue
  • Backbone size w/o insert (bp) 9453
  • Total vector size (bp) 13554
  • Modifications to backbone
    RTTA3 was removed by digestion with MluI and AflII
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Insert Size (bp)
    4101
  • Promoter pCag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer TACAGCTCCTGGGCAACGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cas9 gene was amplified from addgene plasmid 62988
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Neo_CAG-Cas9 was a gift from Ludovic Vallier (Addgene plasmid # 86698 ; http://n2t.net/addgene:86698 ; RRID:Addgene_86698)
  • For your References section:

    Optimized inducible shRNA and CRISPR/Cas9 platforms for in vitro studies of human development using hPSCs. Bertero A, Pawlowski M, Ortmann D, Snijders K, Yiangou L, Cardoso de Brito M, Brown S, Bernard WG, Cooper JD, Giacomelli E, Gambardella L, Hannan NR, Iyer D, Sampaziotis F, Serrano F, Zonneveld MC, Sinha S, Kotter M, Vallier L. Development. 2016 Dec 1;143(23):4405-4418. 10.1242/dev.138081 PubMed 27899508