pcDNA3 tdTomato LIC cloning vector (6F)
(Plasmid
#86963)
-
Purpose(Empty Backbone) Empty LIC vector; adds a tdTomato gene to the C-terminus of your protein of interest.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size (bp) 6859
-
Vector typeMammalian Expression
- Promoter CMV
-
Selectable markersNeomycin (select with G418)
-
Tag
/ Fusion Protein
- tdTomato (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV F (5'cgcaaatgggcggtaggcgtg) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe sequence for tdTomato came from Addgene #62726 (pAAV-Syn-Chronos-tdTomato).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is an empty LIC vector derived from pcDNA3. It adds an tdTomato gene to the C-terminus of your protein of interest.
To clone into this vector, add the following tags to your PCR primers:
LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)
LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC
Do NOT include a stop codon with your reverse primer.
T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 tdTomato LIC cloning vector (6F) was a gift from Chris Jeans (Addgene plasmid # 86963 ; http://n2t.net/addgene:86963 ; RRID:Addgene_86963)