pCDNA-H1-sgRNA-hTZAP
(Plasmid
#87186)
-
PurposeguideRNA targeting exon1 of human TZAP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA-H1-sgRNA
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTZAP
-
gRNA/shRNA sequencecttcgtccagcacagtgtga
-
SpeciesH. sapiens (human)
-
Entrez GeneZBTB48 (a.k.a. HKR3, TZAP, ZNF855, pp9964)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer H1 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA-H1-sgRNA-hTZAP was a gift from Eros Lazzerini Denchi (Addgene plasmid # 87186 ; http://n2t.net/addgene:87186 ; RRID:Addgene_87186) -
For your References section:
TZAP: A telomere-associated protein involved in telomere length control. Li JS, Miralles Fuste J, Simavorian T, Bartocci C, Tsai J, Karlseder J, Lazzerini Denchi E. Science. 2017 Jan 12. pii: aah6752. doi: 10.1126/science.aah6752. 10.1126/science.aah6752 PubMed 28082411