pUM31dao
(Plasmid
#87242)
-
PurposePlastid expression cassette containing Schizosaccharomyces pombe D-amino acid oxidase gene. Provides dual positive (D-alanine) and negative (D-valine) selection in transplastomic plants
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87242 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 2904
- Total vector size (bp) 4611
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameD-amino oxidase
-
Alt namedao
-
SpeciesS. pombe (fission yeast)
-
Insert Size (bp)1047
- Promoter plastid rrn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer GTTGTAAAACGACGGCCAGTG
- 3′ sequencing primer CACACAGGAAACAGCTATGACCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUM31dao was a gift from Anil Day (Addgene plasmid # 87242 ; http://n2t.net/addgene:87242 ; RRID:Addgene_87242) -
For your References section:
Growth of transplastomic cells expressing D-amino acid oxidase in chloroplasts is tolerant to D-alanine and inhibited by D-valine. Gisby MF, Mudd EA, Day A. Plant Physiol. 2012 Dec;160(4):2219-26. doi: 10.1104/pp.112.204107. Epub 2012 Oct 18. 10.1104/pp.112.204107 PubMed 23085840