Skip to main content

pUM31dao
(Plasmid #87242)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87242 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript
  • Backbone size w/o insert (bp) 2904
  • Total vector size (bp) 4611
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    D-amino oxidase
  • Alt name
    dao
  • Species
    S. pombe (fission yeast)
  • Insert Size (bp)
    1047
  • Promoter plastid rrn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer GTTGTAAAACGACGGCCAGTG
  • 3′ sequencing primer CACACAGGAAACAGCTATGACCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUM31dao was a gift from Anil Day (Addgene plasmid # 87242 ; http://n2t.net/addgene:87242 ; RRID:Addgene_87242)
  • For your References section:

    Growth of transplastomic cells expressing D-amino acid oxidase in chloroplasts is tolerant to D-alanine and inhibited by D-valine. Gisby MF, Mudd EA, Day A. Plant Physiol. 2012 Dec;160(4):2219-26. doi: 10.1104/pp.112.204107. Epub 2012 Oct 18. 10.1104/pp.112.204107 PubMed 23085840