Skip to main content
Addgene

pSHS306 - Bacterial expression plasmid for SpCas9, HNH FRET variant
(Plasmid #87350)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87350 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCT10
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 10000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4100
  • Mutation
    C80S/S355C/C574S/S867C
  • Promoter T7
  • Tag / Fusion Protein
    • His-MBP (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAGACTAATTCGAGCTCG
  • 3′ sequencing primer GAAAGGAAGCTGAGTTGGCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Sternberg et al.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSHS306 - Bacterial expression plasmid for SpCas9, HNH FRET variant was a gift from Jennifer Doudna (Addgene plasmid # 87350 ; http://n2t.net/addgene:87350 ; RRID:Addgene_87350)
  • For your References section:

    Conformational control of DNA target cleavage by CRISPR-Cas9. Sternberg SH, LaFrance B, Kaplan M, Doudna JA. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28. 10.1038/nature15544 PubMed 26524520