Skip to main content

pBabe-PI(WT)-Src(YF)-mCherry
(Plasmid #87357)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87357 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBABE
  • Backbone size w/o insert (bp) 5371
  • Total vector size (bp) 8131
  • Modifications to backbone
    different linker between C terminus of LOV and Src than the one in pBabe-PI(WT)-Src(WT)-mCherry
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    LOV2
  • Species
    Synthetic
  • Insert Size (bp)
    447
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer aagtatcgggccctttgtgc
  • 3′ sequencing primer CACCTTCAGCTTGGCGGTCTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Src isoform 2
  • Alt name
    Rous sarcoma oncogene
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2031
  • Mutation
    Y535F
  • GenBank ID
    20779 20779
  • Entrez Gene
    Src (a.k.a. pp60c-src)
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer AAGTTCTTTTGCCGCCTCATC
  • 3′ sequencing primer CACCTTCAGCTTGGCGGTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabe-PI(WT)-Src(YF)-mCherry was a gift from Klaus Hahn (Addgene plasmid # 87357 ; http://n2t.net/addgene:87357 ; RRID:Addgene_87357)
  • For your References section:

    Engineering extrinsic disorder to control protein activity in living cells. Dagliyan O, Tarnawski M, Chu PH, Shirvanyants D, Schlichting I, Dokholyan NV, Hahn KM. Science. 2016 Dec 16;354(6318):1441-1444. 10.1126/science.aah3404 PubMed 27980211