-
PurposeExpresses RRvT, a tandem heterodimer red fluorescent protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBad His B
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 4076
- Total vector size (bp) 5514
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRRvT
-
Alt nameRed-red vine Tomato
-
SpeciesSynthetic
-
Insert Size (bp)1438
- Promoter pBad (Arabinose)
-
Tag
/ Fusion Protein
- His-Tag (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATGGTATGGCTAGCATGACTGGT
- 3′ sequencing primer ACTCAGGAGAGCGTTCAC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBad-HisB-RRvT was a gift from Robert Campbell (Addgene plasmid # 87364 ; http://n2t.net/addgene:87364 ; RRID:Addgene_87364) -
For your References section:
A tandem green-red heterodimeric fluorescent protein with high FRET efficiency. Wiens M, Shen Y, Li X, Salem M, Smisdom N, Zhang W, Brown A, Campbell RE. Chembiochem. 2016 Oct 26. doi: 10.1002/cbic.201600492. 10.1002/cbic.201600492 PubMed 27781394