-
PurposeExpresses HF-BE3 with C-terminal NLS in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87439 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 2999
- Total vector size (bp) 8532
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHF-BE3
-
Alt namerAPOBEC1-XTEN-nHF-Cas9-GGS-UGI-GGS-NLS
-
SpeciesH. sapiens (human), R. norvegicus (rat); Bacillus phage PBS2
-
Insert Size (bp)5133
-
MutationMammalian codon-optimized Cas9-HF
-
Entrez GeneApobec1 (a.k.a. REPR, apobec-1)
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer CCTTGCTGTCCTGCCCCACCCCACC
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HF-BE3 was a gift from David Liu (Addgene plasmid # 87439 ; http://n2t.net/addgene:87439 ; RRID:Addgene_87439) -
For your References section:
Improving the DNA specificity and applicability of base editing through protein engineering and protein delivery. Rees HA, Komor AC, Yeh WH, Caetano-Lopes J, Warman M, Edge ASB, Liu DR. Nat Commun. 2017 Jun 6;8:15790. doi: 10.1038/ncomms15790. 10.1038/ncomms15790 PubMed 28585549