-
PurposeAs pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be used
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJ404
-
Backbone manufacturerDNA2.0
- Backbone size w/o insert (bp) 3822
- Total vector size (bp) 5618
-
Modifications to backboneT5 promoter replaced with PrhaBAD-sfGFP, rhaS and its RBS placed downstream of ampR leading to constitutive expression of rhaS on plasmid.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePrhaBAD-sfGFP
-
Alt namerhamnose promoter
-
Alt namesuperfolder GFP
-
SpeciesE. coli
-
Insert Size (bp)925
- Promoter PrhaBAD rhamnose-inducible promoter from E. coli
-
Tag
/ Fusion Protein
- 6xHis Tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer gctcagtcgaaagactgggcctttcgc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namerhaS from E. coli with its native RBS from E. coli
-
Alt namegene encoding transcriptional activator of the rhaBAD operon
-
SpeciesE. coli
-
Insert Size (bp)871
- Promoter ampR promoter on pJ404
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggttctcgcggtatcatcgc
- 3′ sequencing primer attcaccaccctgaattgactctcttcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypJT118-sfGFP (Programming Microbes Using Pulse Width Modulation of Optical Signals Davidson, Eric A.; Basu, Amar S.; Bayer, Travis S. Journal of Molecular Biology (2013), 425 (22), 4161-4166 CODEN: JMOBAK; ISSN:0022-2836.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK302 was a gift from John Heap (Addgene plasmid # 87768 ; http://n2t.net/addgene:87768 ; RRID:Addgene_87768) -
For your References section:
Synthetic Chemical Inducers and Genetic Decoupling Enable Orthogonal Control of the rhaBAD Promoter. Kelly CL, Liu Z, Yoshihara A, Jenkinson SF, Wormald MR, Otero J, Estevez A, Kato A, Marqvorsen MH, Fleet GW, Estevez RJ, Izumori K, Heap JT. ACS Synth Biol. 2016 Oct 21;5(10):1136-1145. Epub 2016 Jun 21. 10.1021/acssynbio.6b00030 PubMed 27247275