tet-pLKO shMKP1.v2 puro
(Plasmid
#87791)
-
PurposeExpresses an inducible short hairpin targeting human MKP1 sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87791 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTet PLKO puro
-
Backbone manufacturerPlasmid #21915
- Backbone size w/o insert (bp) 10633
- Total vector size (bp) 8816
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshMKP1
-
gRNA/shRNA sequenceTCGAGAGGGCTGGTCCTTATT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_004417.3
-
Entrez GeneDUSP1 (a.k.a. CL100, HVH1, MKP-1, MKP1, PTPN10)
- Promoter TRE tight
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tet-pLKO shMKP1.v2 puro was a gift from Kevin Janes (Addgene plasmid # 87791 ; http://n2t.net/addgene:87791 ; RRID:Addgene_87791) -
For your References section:
Profiling Subcellular Protein Phosphatase Responses to Coxsackievirus B3 Infection of Cardiomyocytes. Shah M, Smolko CM, Kinicki S, Chapman ZD, Brautigan DL, Janes KA. Mol Cell Proteomics. 2017 Apr;16(4 suppl 1):S244-S262. doi: 10.1074/mcp.O116.063487. Epub 2017 Feb 7. 10.1074/mcp.O116.063487 PubMed 28174228