Skip to main content
Addgene

pcDNA5-EGFP-NLS-T2A-mCherry-PTS1
(Plasmid #87827)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87827 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5137
  • Total vector size (bp) 6629
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    NLS
  • Alt name
    nuclear localization signal of SV40 large T antigen
  • Species
    Synthetic
  • Insert Size (bp)
    21
  • GenBank ID
    none
  • Promoter CMV promoter, tetracycline operator
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CAACGAGAAGCGCGATC
  • 3′ sequencing primer GTCACCTTCAGCTTGGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PTS1
  • Alt name
    peroxisomal targeting signal 1
  • Species
    Synthetic
  • Insert Size (bp)
    15
  • GenBank ID
    none
  • Promoter CMV promoter, tetracycline operator
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CAAGTTGGACATCACCTCCCAC
  • 3′ sequencing primer CACCTACTCAGACAATGCGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

No stop codon should be placed at the 3' end of the first insert for proper co-expression using 2A-peptide.

Please cite: Pan D, Klare K, Petrovic A, Take A, Walstein K, Singh P, Rondelet A, Bird AW, Musacchio A (2017) CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading. Elife 6. doi: 10.7554/eLife.23352.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5-EGFP-NLS-T2A-mCherry-PTS1 was a gift from Andrea Musacchio (Addgene plasmid # 87827 ; http://n2t.net/addgene:87827 ; RRID:Addgene_87827)
  • For your References section:

    CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading. Pan D, Klare K, Petrovic A, Take A, Walstein K, Singh P, Rondelet A, Bird AW, Musacchio A. Elife. 2017 Jan 6;6. pii: e23352. doi: 10.7554/eLife.23352. 10.7554/eLife.23352 PubMed 28059702