pAAV-EF1a-FLuc-WPRE-HGHpA
(Plasmid
#87951)
-
PurposeRecombinant single-stranded AAV transfer vector expressing Firefly Luciferase under the EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV with AAV2 ITRs
- Total vector size (bp) 6983
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNeed to check ITR presence and orientation every time you amplify to ensure the ITRs haven't recombined. Perform a restriction digest with XmaI (only cuts in the ITRs, should produce two bands of approximate sizes 2.7kb and 4.2kb)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
Alt nameFLuc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1653
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI, NcoI, MreI (unknown if destroyed)
- 3′ cloning site EcoRI, EcoRV (unknown if destroyed)
- 5′ sequencing primer GGGTTTTATGCGATGGAGTTTC
- 3′ sequencing primer AGGTGCCTAAAGGACTGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-FLuc-WPRE-HGHpA was a gift from Mark Kay (Addgene plasmid # 87951 ; http://n2t.net/addgene:87951 ; RRID:Addgene_87951) -
For your References section:
Bioengineered AAV Capsids with Combined High Human Liver Transduction In Vivo and Unique Humoral Seroreactivity. Paulk NK, Pekrun K, Zhu E, Nygaard S, Li B, Xu J, Chu K, Leborgne C, Dane AP, Haft A, Zhang Y, Zhang F, Morton C, Valentine MB, Davidoff AM, Nathwani AC, Mingozzi F, Grompe M, Alexander IE, Lisowski L, Kay MA. Mol Ther. 2017 Sep 25. pii: S1525-0016(17)30437-9. doi: 10.1016/j.ymthe.2017.09.021. 10.1016/j.ymthe.2017.09.021 PubMed 29055620