pTE4254
(Plasmid
#89050)
-
PurposeExpresses St chimeric gRNA and human codon-optimized StCas9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.3-TOPO
- Backbone size w/o insert (bp) 5805
- Total vector size (bp) 9202
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSt chimeric gRNA
-
Alt nameStreptococcus thermophilus guideRNA
-
Insert Size (bp)152
- Promoter human U6
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer AAAACAGGAAGGCAAAATGC
- 3′ sequencing primer ggtcgggcaggaagaggg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehStCas9
-
Alt namehuman codon-optimized Streptococcus thermophilus Cas9 nuclease
-
Insert Size (bp)3372
- Promoter CMV
-
Tag
/ Fusion Protein
- SV40 NLS (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCGCTGGCAAGTGTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE4254 was a gift from Ervin Welker (Addgene plasmid # 89050 ; http://n2t.net/addgene:89050 ; RRID:Addgene_89050) -
For your References section:
Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Toth E, Weinhardt N, Bencsura P, Huszar K, Kulcsar PI, Talas A, Fodor E, Welker E. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. 10.1186/s13062-016-0147-0 [pii] PubMed 27630115