Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #90094)


Item Catalog # Description Quantity Price (USD)
Plasmid 90094 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6643
  • Total vector size (bp) 10553
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    FnCpf1 (humanized)
  • Alt name
    type V CRISPR-associated protein Cpf1 (humanized)
  • Alt name
    Cpf1 (humanized)
  • Alt name
    Francisella tularensis subsp. novicida U112 Cpf1 (humanized)
  • Species
    Francisella tularensis subsp. novicida U112
  • Insert Size (bp)
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • MBP (N terminal on insert)
    • TEV site (N terminal on insert)
    • Nucleoplasmin NLS (C terminal on insert)
    • 3xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg´┐Ż
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Note: a Flag-AviTag containing fragment follows the insert (between the XhoI and HindIII sites) but this sequence is not translated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    6-His-MBP-TEV-FnCpf1 was a gift from Feng Zhang (Addgene plasmid # 90094 ; ; RRID:Addgene_90094)
  • For your References section:

    Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. 10.1016/j.cell.2015.09.038 PubMed 26422227