-
PurposeBacterial expression plasmid for protein purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-28
- Backbone size w/o insert (bp) 6643
- Total vector size (bp) 10553
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFnCpf1 (humanized)
-
Alt nametype V CRISPR-associated protein Cpf1 (humanized)
-
Alt nameCpf1 (humanized)
-
Alt nameFrancisella tularensis subsp. novicida U112 Cpf1 (humanized)
-
SpeciesFrancisella tularensis subsp. novicida U112
-
Insert Size (bp)3910
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on backbone)
- MBP (N terminal on insert)
- TEV site (N terminal on insert)
- Nucleoplasmin NLS (C terminal on insert)
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg� (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: a Flag-AviTag containing fragment follows the insert (between the XhoI and HindIII sites) but this sequence is not translated.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6-His-MBP-TEV-FnCpf1 was a gift from Feng Zhang (Addgene plasmid # 90094 ; http://n2t.net/addgene:90094 ; RRID:Addgene_90094) -
For your References section:
Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. 10.1016/j.cell.2015.09.038 PubMed 26422227