Skip to main content

1179_pAAV-U6-BbsI-gRNA-CB-EmGFP
(Plasmid #89060)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89060 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pEMBL8
  • Backbone size w/o insert (bp) 2508
  • Total vector size (bp) 4596
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EmGFP
  • gRNA/shRNA sequence
    gggtcttcgagaagacct
  • Species
    Aequorea Victoria
  • Promoter Chicken beta actin with partial CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCTTCATATTTGCATATACGATACAAGGCTGTTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1179_pAAV-U6-BbsI-gRNA-CB-EmGFP was a gift from William Lagor (Addgene plasmid # 89060 ; http://n2t.net/addgene:89060 ; RRID:Addgene_89060)
  • For your References section:

    Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease. Jarrett KE, Lee CM, Yeh YH, Hsu RH, Gupta R, Zhang M, Rodriguez PJ, Lee CS, Gillard BK, Bissig KD, Pownall HJ, Martin JF, Bao G, Lagor WR. Sci Rep. 2017 Mar 16;7:44624. doi: 10.1038/srep44624. 10.1038/srep44624 PubMed 28300165