-
Purposehis7 integration plasmid with Z3EVpr:GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSSK-His7(F)
-
Backbone manufacturerApolinario, E., Nocero, M., Jin, M., & Hoffman, C. S. (1993). Current Genetics, 24(6), 491–495.
- Backbone size w/o insert (bp) 5763
- Total vector size (bp) 7503
-
Modifications to backboneAdded Z3EV promoter, GFP-NLS CDS, and leu1 C-terminal 300nt
-
Vector typeS. pombe his7 integration vector
-
Selectable markersS. pombe his7
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZ3EV promoter GFP-NLS leu1 C-terminal 300 nt
-
SpeciesSynthetic
-
Insert Size (bp)1740
- Promoter Z3EV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agattccccatggaaggaag
- 3′ sequencing primer attcctattgcaatgggctt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMcIsaac, R.S. et al., 2011. Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae. Molecular biology of the cell, 22(22), pp.4447–59. McIsaac, R.S. et al., 2014. Synthetic biology tools for programming gene expression without nutritional perturbations in Saccharomyces cerevisiae. Nucleic Acids Research, 42(6), pp.1–8.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFS462 was a gift from Nick Rhind (Addgene plasmid # 89065 ; http://n2t.net/addgene:89065 ; RRID:Addgene_89065) -
For your References section:
An estradiol-inducible promoter enables fast, graduated control of gene expression in fission yeast. Ohira MJ, Hendrickson DG, Scott McIsaac R, Rhind N. Yeast. 2017 Aug;34(8):323-334. doi: 10.1002/yea.3235. Epub 2017 Jun 8. 10.1002/yea.3235 PubMed 28423198