Skip to main content

pFS462
(Plasmid #89065)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89065 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBSSK-His7(F)
  • Backbone manufacturer
    Apolinario, E., Nocero, M., Jin, M., & Hoffman, C. S. (1993). Current Genetics, 24(6), 491–495.
  • Backbone size w/o insert (bp) 5763
  • Total vector size (bp) 7503
  • Modifications to backbone
    Added Z3EV promoter, GFP-NLS CDS, and leu1 C-terminal 300nt
  • Vector type
    S. pombe his7 integration vector
  • Selectable markers
    S. pombe his7

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Z3EV promoter GFP-NLS leu1 C-terminal 300 nt
  • Species
    Synthetic
  • Insert Size (bp)
    1740
  • Promoter Z3EV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agattccccatggaaggaag
  • 3′ sequencing primer attcctattgcaatgggctt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    McIsaac, R.S. et al., 2011. Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae. Molecular biology of the cell, 22(22), pp.4447–59. McIsaac, R.S. et al., 2014. Synthetic biology tools for programming gene expression without nutritional perturbations in Saccharomyces cerevisiae. Nucleic Acids Research, 42(6), pp.1–8.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFS462 was a gift from Nick Rhind (Addgene plasmid # 89065 ; http://n2t.net/addgene:89065 ; RRID:Addgene_89065)
  • For your References section:

    An estradiol-inducible promoter enables fast, graduated control of gene expression in fission yeast. Ohira MJ, Hendrickson DG, Scott McIsaac R, Rhind N. Yeast. 2017 Aug;34(8):323-334. doi: 10.1002/yea.3235. Epub 2017 Jun 8. 10.1002/yea.3235 PubMed 28423198