pTX198
(Plasmid
#89262)
-
PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTX172
-
Vector typePlant Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOsPDS-gRNA01
-
gRNA/shRNA sequenceGTTGGTCTTTGCTCCTGCAG
- Promoter Maize Ubiquitin1 promoter
-
Tag
/ Fusion Protein
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 3′ sequencing primer ZY065-RB: TTCTAATAAACGCTCTTTTCTCT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTX198 was a gift from Daniel Voytas (Addgene plasmid # 89262 ; http://n2t.net/addgene:89262 ; RRID:Addgene_89262) -
For your References section:
A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Tang X, Zheng X, Qi Y, Zhang D, Cheng Y, Tang A, Voytas DF, Zhang Y. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. 10.1016/j.molp.2016.05.001 PubMed 27212389