-
PurposeExpresses humanized AsCpf1 TATV PAM variant and crRNA guide
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89354 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89354-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89354-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC ori vector
- Backbone size w/o insert (bp) 4328
- Total vector size (bp) 8435
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCpf1 RVR variant
-
Alt nameAsCas12a, RVR variant
-
SpeciesSynthetic; Acidaminococcus sp.
-
Insert Size (bp)4107
-
MutationS542R/K548V/N552R
- Promoter CBh
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS-3xHA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGGATGGTTGGTTGGTGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This variant also recognizes TTTV and RATR PAMs (R = A or G).
Contains a U6-crRNA expression cassette (BbsI restriction sites for guide cloning).
For more information on Zhang lab CRISPR plasmids, please refer to www.addgene.org/crispr/zhang/.
DNA (Catalog # 89354-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89354-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAsCpf1(TATV)(BB) (pY221) was a gift from Feng Zhang (Addgene plasmid # 89354 ; http://n2t.net/addgene:89354 ; RRID:Addgene_89354) -
For your References section:
Engineered Cpf1 variants with altered PAM specificities. Gao L, Cox DBT, Yan WX, Manteiga JC, Schneider MW, Yamano T, Nishimasu H, Nureki O, Crosetto N, Zhang F. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. 10.1038/nbt.3900 PubMed 28581492