Skip to main content
Addgene
Open Menu

pRFHUE-eGFP
(Plasmid #89469)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89469 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 89469-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 89469-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pRFHUE
  • Vector type
    Binary plasmid for ATMT of filamentous fungi
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter A. nidulans gpdA

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTGCGTCAGTCCAACATTTGTTGCCA
  • 3′ sequencing primer GAAGCCTGCGAAGAGTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Binary plasmid for ATMT of filamentous fungi. The T-DNA contains a Hygromycin resistance gene under the control of A. nidulans trpC gen promoter and terminator

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRFHUE-eGFP was a gift from Luis González-Candelas (Addgene plasmid # 89469 ; http://n2t.net/addgene:89469 ; RRID:Addgene_89469)

  • For your References section:

    Development of a green fluorescent tagged strain of Aspergillus carbonarius to monitor fungal colonization in grapes. Crespo-Sempere A, Lopez-Perez M, Martinez-Culebras PV, Gonzalez-Candelas L. Int J Food Microbiol. 2011 Aug 2;148(2):135-40. doi: 10.1016/j.ijfoodmicro.2011.05.021. Epub 2011 May 30. 10.1016/j.ijfoodmicro.2011.05.021 PubMed 21663991
Related items:
Commonly requested with: