-
PurposeGFP labelling of filamentous fungi by Agrobacterium tumefaciens mediated transformation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRFHUE
-
Vector typeBinary plasmid for ATMT of filamentous fungi
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter A. nidulans gpdA
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTGCGTCAGTCCAACATTTGTTGCCA
- 3′ sequencing primer GAAGCCTGCGAAGAGTTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Binary plasmid for ATMT of filamentous fungi. The T-DNA contains a Hygromycin resistance gene under the control of A. nidulans trpC gen promoter and terminator
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRFHUE-eGFP was a gift from Luis González-Candelas (Addgene plasmid # 89469 ; http://n2t.net/addgene:89469 ; RRID:Addgene_89469) -
For your References section:
Development of a green fluorescent tagged strain of Aspergillus carbonarius to monitor fungal colonization in grapes. Crespo-Sempere A, Lopez-Perez M, Martinez-Culebras PV, Gonzalez-Candelas L. Int J Food Microbiol. 2011 Aug 2;148(2):135-40. doi: 10.1016/j.ijfoodmicro.2011.05.021. Epub 2011 May 30. 10.1016/j.ijfoodmicro.2011.05.021 PubMed 21663991