Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pET22-His-TEV-DOT1L
(Plasmid #89610)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89610 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET-22
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5346
  • Total vector size (bp) 6639
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Dot1L
  • Alt name
    Histone-lysine N-methyltransferase, H3 lysine-79 specific
  • Alt name
    DOT1-like protein
  • Alt name
    Lysine N-methyltransferase 4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1293
  • GenBank ID
    AF509504
  • Entrez Gene
    DOT1L (a.k.a. DOT1, KMT4)
  • Promoter T7
  • Tag / Fusion Protein
    • His-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22-His-TEV-DOT1L was a gift from Leemor Joshua-Tor (Addgene plasmid # 89610 ; http://n2t.net/addgene:89610 ; RRID:Addgene_89610)
  • For your References section:

    Rapid generation of drug-resistance alleles at endogenous loci using CRISPR-Cas9 indel mutagenesis. Ipsaro JJ, Shen C, Arai E, Xu Y, Kinney JB, Joshua-Tor L, Vakoc CR, Shi J. PLoS One. 2017 Feb 23;12(2):e0172177. doi: 10.1371/journal.pone.0172177. eCollection 2017. PONE-D-16-48894 [pii] PubMed 28231254