pET22-His-TEV-DOT1L-MM
(Plasmid
#89611)
-
PurposeBacterial expression vector for an N-terminally His-tagged (TEV-cleavable) version of human Dot1L hypermorphic MM mutant residues 1-416
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-22
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5346
- Total vector size (bp) 6633
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDot1L VVEL293MM Mutant
-
Alt nameHistone-lysine N-methyltransferase, H3 lysine-79 specific
-
Alt nameDOT1-like protein
-
Alt nameLysine N-methyltransferase 4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1287
-
GenBank IDAK074120
-
Entrez GeneDOT1L (a.k.a. DOT1, KMT4)
- Promoter T7
-
Tag
/ Fusion Protein
- His-TEV (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22-His-TEV-DOT1L-MM was a gift from Leemor Joshua-Tor (Addgene plasmid # 89611 ; http://n2t.net/addgene:89611 ; RRID:Addgene_89611) -
For your References section:
Rapid generation of drug-resistance alleles at endogenous loci using CRISPR-Cas9 indel mutagenesis. Ipsaro JJ, Shen C, Arai E, Xu Y, Kinney JB, Joshua-Tor L, Vakoc CR, Shi J. PLoS One. 2017 Feb 23;12(2):e0172177. doi: 10.1371/journal.pone.0172177. eCollection 2017. PONE-D-16-48894 [pii] PubMed 28231254