His8-TEV-PseH
              
              
                (Plasmid
                
                #89725)
              
            
            
            
          - 
            PurposeExpresses PseH from C. jejuni with an N-terminal 2xHis Gln 5x His feature, followed by the TEV cleavage site
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepET30b (+)
- 
              Backbone manufacturerEMB Biosciences
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 5874
- 
              Modifications to backboneIncorporation of N-terminal OctaHis tag and TEV cleavage site before insert
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert namePseH
- 
                    SpeciesCampylobacter jejuni
- 
                  Insert Size (bp)474
- 
                    GenBank ID905605
- 
                        Entrez GenepseH (a.k.a. Cj1313)
- 
    
        Tags
        / Fusion Proteins
    - 2xHis Gln 5xHis (N terminal on backbone)
- TEV (N terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TTGATAAAACTTAAAAATTTCGCAGAACTTAATTCTCAAGAA
- 3′ sequencing primer TTAGCTAGGCAAGGCTTTGCAGTGAGATTGCTTTAAGC (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: His8-TEV-PseH was a gift from Barbara Imperiali (Addgene plasmid # 89725 ; http://n2t.net/addgene:89725 ; RRID:Addgene_89725)
- 
                For your References section: Chemoenzymatic Synthesis and Applications of Prokaryote-Specific UDP-Sugars. Zamora CY, Schocker NS, Chang MM, Imperiali B. Methods Enzymol. 2017;597:145-186. doi: 10.1016/bs.mie.2017.06.003. Epub 2017 Jul 5. 10.1016/bs.mie.2017.06.003 PubMed 28935101
