Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSUPER-retro-puro-shSTIM1
(Plasmid #89816)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89816 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSUPER-puro
  • Backbone manufacturer
    oligoengine
  • Backbone size w/o insert (bp) 4400
  • Total vector size (bp) 4400
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    STIM1 shRNA
  • gRNA/shRNA sequence
    AGAAGGAGCTAGAATCTCAC
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001277961.1
  • Entrez Gene
    STIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSUPER-retro-puro-shSTIM1 was a gift from Shengyu Yang (Addgene plasmid # 89816 ; http://n2t.net/addgene:89816 ; RRID:Addgene_89816)
  • For your References section:

    STIM1- and Orai1-mediated Ca(2+) oscillation orchestrates invadopodium formation and melanoma invasion. Sun J, Lu F, He H, Shen J, Messina J, Mathew R, Wang D, Sarnaik AA, Chang WC, Kim M, Cheng H, Yang S. J Cell Biol. 2014 Nov 24;207(4):535-48. doi: 10.1083/jcb.201407082. Epub 2014 Nov 17. 10.1083/jcb.201407082 PubMed 25404747