-
PurposeEGFP reporter vector for iTango system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSyc 181 P2A
- Total vector size (bp) 4855
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametetO-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)4855
- Promoter TetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer cgcctggagacgccatcc
- 3′ sequencing primer GTAATACGACTCACTATAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE-EGFP was a gift from Hyungbae Kwon (Addgene plasmid # 89871 ; http://n2t.net/addgene:89871 ; RRID:Addgene_89871) -
For your References section:
Temporally precise labeling and control of neuromodulatory circuits in the mammalian brain. Lee D, Creed M, Jung K, Stefanelli T, Wendler DJ, Oh WC, Mignocchi NL, Luscher C, Kwon HB. Nat Methods. 2017 May;14(5):495-503. doi: 10.1038/nmeth.4234. Epub 2017 Apr 3. 10.1038/nmeth.4234 PubMed 28369042