Skip to main content

pCMV dCas9-MC (eGFP)
(Plasmid #89931)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89931 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4156
  • Total vector size (bp) 8873
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-MC
  • Alt name
    NLS-Flag-dCas9-lfl-M.SssI[273-386]-NLS
  • Species
    Synthetic
  • Insert Size (bp)
    4671
  • Mutation
    deactivated Cas9, fragment of M.SssI (residues 273-386)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGTACGGTGGGAGG
  • 3′ sequencing primer gcttgccaaacctacaggtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Does not contain active methylatransferase - general cloning strains can be used.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV dCas9-MC (eGFP) was a gift from Carl Novina (Addgene plasmid # 89931 ; http://n2t.net/addgene:89931 ; RRID:Addgene_89931)
  • For your References section:

    Targeted DNA methylation in human cells using engineered dCas9-methyltransferases. Xiong T, Meister GE, Workman RE, Kato NC, Spellberg MJ, Turker F, Timp W, Ostermeier M, Novina CD. Sci Rep. 2017 Jul 27;7(1):6732. doi: 10.1038/s41598-017-06757-0. 10.1038/s41598-017-06757-0 [pii] PubMed 28751638