pLentiPGK Puro DEST JNKKTR AE Clover
(Plasmid
#90240)
-
PurposeLentiviral vector to express JNK KTR AE (mutant) mClover under PGK promoter (With Puromycin Resistance)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLENTI PGK Puro DEST (w529-2)
-
Backbone manufacturerEric Campeau Lab (Addgene Plasmid 19068)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameJNK Kinase Translocation Reporter (AE mutant)
-
SpeciesH. sapiens (human), M. musculus (mouse)
- Promoter PGK
-
Tag
/ Fusion Protein
- mClover (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACCGAATCACCGACCTCTCT
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
JNKKTR AE has an M11I mutation compared to WT JNKKTR. The mutation does not alter plasmid function as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiPGK Puro DEST JNKKTR AE Clover was a gift from Markus Covert (Addgene plasmid # 90240 ; http://n2t.net/addgene:90240 ; RRID:Addgene_90240) -
For your References section:
Live-cell measurements of kinase activity in single cells using translocation reporters. Kudo T, Jeknic S, Macklin DN, Akhter S, Hughey JJ, Regot S, Covert MW. Nat Protoc. 2018 Jan;13(1):155-169. doi: 10.1038/nprot.2017.128. Epub 2017 Dec 21. 10.1038/nprot.2017.128 PubMed 29266096