pLKO-Tet-On-HDAC1-shRNA1
(Plasmid
#90242)
-
PurposeLentivirus for expression of shRNA1 against human HDAC1 (Dox-inducible)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90242 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTet-pLKO-Puro (pLKO-Tet-On) Addgene #21915
-
Backbone manufacturerDmitri Wiederschain
- Backbone size w/o insert (bp) 8758
- Total vector size (bp) 8815
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHDAC1
-
gRNA/shRNA sequenceCGTTCTTAACTTTGAACCATA
-
SpeciesH. sapiens (human)
-
Entrez GeneHDAC1 (a.k.a. GON-10, HD1, KDAC1, RPD3, RPD3L1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer SHSEQ2 GGAAATCACCATAAACGTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-Tet-On-HDAC1-shRNA1 was a gift from Roland Friedel (Addgene plasmid # 90242 ; http://n2t.net/addgene:90242 ; RRID:Addgene_90242)