-
PurposeMinigene reporter for alternative splicing analysis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepflareA
- Total vector size (bp) 6703
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepsd95-exon18
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)977
-
Entrez GeneDlg4 (a.k.a. Dlgh4, PSD-95, PSD95, SAP90, SAP90A)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGATCTACCATTGGTGCACCTGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pflareA-psd95-exon18. was a gift from Douglas Black (Addgene plasmid # 90249 ; http://n2t.net/addgene:90249 ; RRID:Addgene_90249) -
For your References section:
A broadly applicable high-throughput screening strategy identifies new regulators of Dlg4 (Psd-95) alternative splicing. Zheng S, Damoiseaux R, Chen L, Black DL. Genome Res. 2013 Jun;23(6):998-1007. doi: 10.1101/gr.147546.112. Epub 2013 May 1. 10.1101/gr.147546.112 PubMed 23636947