Skip to main content

pSH1
(Plasmid #90295)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90295 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p4P1R
  • Backbone manufacturer
    Frederick Mann, Kim Lab
  • Backbone size w/o insert (bp) 4463
  • Total vector size (bp) 6239
  • Modifications to backbone
    This p4P1R vector already contains a 2kb insert of ges-1 promoter.
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fat-7
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1776
  • Entrez Gene
    fat-7 (a.k.a. CELE_F10D2.9)
  • Promoter ges-1
  • Tag / Fusion Protein
    • No

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGACGGTAAAAACTCGCGC
  • 3′ sequencing primer TTACATGATCGATTTTTTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH1 was a gift from Anne Brunet (Addgene plasmid # 90295 ; http://n2t.net/addgene:90295 ; RRID:Addgene_90295)
  • For your References section:

    Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan. Han S, Schroeder EA, Silva-Garcia CG, Hebestreit K, Mair WB, Brunet A. Nature. 2017 Apr 13;544(7649):185-190. doi: 10.1038/nature21686. Epub 2017 Apr 5. 10.1038/nature21686 PubMed 28379943