pExchange_tdk_BT1311p-tetR-3
(Plasmid
#90327)
-
PurposeSuicide vector for integration of a constitutively expressed TetR by promoter BT1311 at B. thetatiotaomicron genomic position 6193956 and 6193957
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepExchange-tdk
-
Vector typeBacterial Expression
-
Selectable markersErythromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTetR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGAGACAGCCGAATACGA
- 3′ sequencing primer AACACTTAACGGCTGACATGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's sequencing results found multiple mutations in ermG. The depositing lab confirmed that these mutations do not compromise erythromycin selection.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pExchange_tdk_BT1311p-tetR-3 was a gift from Andrew Goodman (Addgene plasmid # 90327 ; http://n2t.net/addgene:90327 ; RRID:Addgene_90327) -
For your References section:
Engineered Regulatory Systems Modulate Gene Expression of Human Commensals in the Gut. Lim B, Zimmermann M, Barry NA, Goodman AL. Cell. 2017 Apr 20;169(3):547-558.e15. doi: 10.1016/j.cell.2017.03.045. 10.1016/j.cell.2017.03.045 PubMed 28431252