Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pExchange_tdk_BT1311p-tetR-3
(Plasmid #90327)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 90327 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pExchange-tdk
  • Vector type
    Bacterial Expression
  • Selectable markers
    Erythromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TetR

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAGAGACAGCCGAATACGA
  • 3′ sequencing primer AACACTTAACGGCTGACATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's sequencing results found multiple mutations in ermG. The depositing lab confirmed that these mutations do not compromise erythromycin selection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pExchange_tdk_BT1311p-tetR-3 was a gift from Andrew Goodman (Addgene plasmid # 90327 ; http://n2t.net/addgene:90327 ; RRID:Addgene_90327)
  • For your References section:

    Engineered Regulatory Systems Modulate Gene Expression of Human Commensals in the Gut. Lim B, Zimmermann M, Barry NA, Goodman AL. Cell. 2017 Apr 20;169(3):547-558.e15. doi: 10.1016/j.cell.2017.03.045. 10.1016/j.cell.2017.03.045 PubMed 28431252