Skip to main content

sgSf3b1(T1)
(Plasmid #90424)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90424 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR ; guideRNA encoding for gene editing
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mus Sf3b1 gRNA
  • Alt name
    SAP155
  • gRNA/shRNA sequence
    Sf3b1
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Sf3b1 (a.k.a. 155kDa, 2810001M05Rik, Prp10, SAP155, SF3b155, TA-8, Targ4)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgSf3b1(T1) was a gift from Alex Minella (Addgene plasmid # 90424 ; http://n2t.net/addgene:90424 ; RRID:Addgene_90424)
  • For your References section:

    Degenerate minigene library analysis enables identification of altered branch point utilization by mutant splicing factor 3B1 (SF3B1). Gupta AK, Murthy T, Paul KV, Ramirez O, Fisher JB, Rao S, Rosenberg AB, Seelig G, Minella AC, Pillai MM. Nucleic Acids Res. 2018 Nov 20. pii: 5193340. doi: 10.1093/nar/gky1161. 10.1093/nar/gky1161 PubMed 30462273