pBABE-zeo small T H42Q
(Plasmid
#9065)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 9065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBABE-zeo
- Backbone size w/o insert (bp) 4800
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSV40 small T Antigen
-
Speciessimian virus
-
Insert Size (bp)520
-
Entrez GeneSV40gp7 (a.k.a. SV40gp7)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pBABE 5'
- 3′ sequencing primer pBABE 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A retrovirus encoding the SV40 small t (ST) oncoprotein was constructed by amplifying the ST sequences by PCR using the vector pVU- (30) and the oligonucleotides B5ST (5' GGCGGATCCGCCACCATGGATAAAGTTTT 3') and E3ST (5'AGGCGAATTCTTAGAGCTTTAAATCTCTG 3'). The resulting fragment was sequenced and introduced into pMIG (pMIG-ST) (81) and pBABE-zeo. H42Q mutant.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBABE-zeo small T H42Q was a gift from Bob Weinberg (Addgene plasmid # 9065 ; http://n2t.net/addgene:9065 ; RRID:Addgene_9065) -
For your References section:
Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Hahn WC, Dessain SK, Brooks MW, King JE, Elenbaas B, Sabatini DM, DeCaprio JA, Weinberg RA. Mol Cell Biol 2002 Apr;22(7):2111-23. 10.1128/MCB.22.7.2111-2123.2002 PubMed 11884599